# draft_gc_content.py
# Purpose: A function that computes the percentage of G's and C's in a DNA sequence 
# 

def gc_count(seq):
    """Compute the percentage of G and C in a DNA sequence"""

    total_length = XXXXXXXXXX
    gc_count = XXXXXXXXXX
    # for each base pair in the string,
    for bp in seq:
    # next, if the bp is a G or a C,
        if XXXXXXXXXX:
        # increment the count of gc
            XXXXXXXXXX

    # divide the gc_count by the total_count
    XXXXXXXXXX = (XXXXXXXXXX(gc_count) / total_length)*XXXXXXXXXX
    return(gc_content)

dna = "GCAACCGGTTACGCAAACAG"
print dna
# Print the answer
print 'GC content:', gc_count(dna)